Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 13960725 13964875 enh97622

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 13963415 rs115943698 G A 8093999
chr5 13963418 rs191648819 G A 8094000
chr5 13963418 rs377693829 GGCTCACGCCTATAATCCCA G 8094001
chr5 13963418 rs554224254 GGCTCACGCCTATAATCCCA G 8094002

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results