Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 14628925 14633075 enh105888

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 14631889 rs558426910 CCAAATGGTTATTAGACAGAAATGATTTT C 8098669

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results