EnhancerDB
  1. Home
  2. TFBS
  3. NR3C1[chr5:73630215-73630232]
Chromosome characteristics of NR3C1[chr5:73630215-73630232]
Back to top
Enhancers possibly regulated by NR3C1[chr5:73630215-73630232]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 73627405 73634495 enh55325
Bone Marrow (K562) Ovary Large Intestine
SNP sites on NR3C1[chr5:73630215-73630232]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 73630218 rs141438586 GCACATTGTCTCCTAAACCAAAT G 8308501
chr5 73630218 rs369507780 GCACATTGTCTCCTAAACCAAAT G 8308502
Genes possibly regulated by NR3C1[chr5:73630215-73630232]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by NR3C1[chr5:73630215-73630232]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results