Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 82959565 82963715 enh83787

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 82959699 rs148335609 TCTCACCTGAACTTTCAAGATC T 8352109

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results