Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 90684205 90688355 enh108993

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 90686971 rs554971529 GGATATGCATGCTATTGTAAA G 8374073

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results