Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 91070385 91075675 enh77674

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 91075016 rs537151906 G GATATATTTATATCTTGGATGCA 8375200

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results