EnhancerDB
  1. Home
  2. TFBS
  3. NR4A2[chr5:91629390-91629398]
Chromosome characteristics of NR4A2[chr5:91629390-91629398]
Back to top
Enhancers possibly regulated by NR4A2[chr5:91629390-91629398]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 91625965 91630115 enh83841
Prostate (PC-3)
SNP sites on NR4A2[chr5:91629390-91629398]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 91629393 rs534398993 G C 8376304
chr5 91629393 rs552492051 G GACCTTGTGATCTTCCCTCCTC 8376305
Genes possibly regulated by NR4A2[chr5:91629390-91629398]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by NR4A2[chr5:91629390-91629398]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results