Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 91735305 91742195 enh38099

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 91738203 rs574025815 A ATATGTATCATAAGGTAATGATACATATAAT 8376501

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results