Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 95302865 95311993 enh38134

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 95307846 rs376841607 T TTGTAGATATAAGGTCTCACTG 8387665
chr5 95307846 rs57096202 T TTGTAGATATAAGGTCTCACTG 8387666

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results