Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 151374105 151384850 enh77099

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 151384433 rs151298958 AGGCTGTATTTGTTCCTTGCT A 7114233

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results