Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 145430425 145434575 enh77750

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 145433091 rs372078309 CCCTCTTGGGATTTGGAAACTTGA C 8591877

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results