Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 145804485 145810595 enh55525

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 145810074 rs573423843 GTAAATTTTAGAGTGAAAATTTAATC G 8593110

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results