Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 147252045 147256195 enh84008

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 147253033 rs138115908 GGAAATAAGGGATTGGGGCACA G 8599005
chr5 147253033 rs368114918 GGAAATAAGGGATTGGGGCACA G 8599006

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results