Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 149142682 149146844 enh90333

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 149142709 rs149469569 TTCCCTCCCCACTCTGGCCCTGCAGCC T 8610706
chr5 149142709 rs58574774 TTCCCTCCCCACTCTGGCCCTGCAGCC T 8610707

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results