Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 149347185 149351335 enh55538

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 149348391 rs11274810 TTGTGCCTCAGCTTGCTGAGTAGC T 8612111
chr5 149348391 rs57481745 TTGTGCCTCAGCTTGCTGAGTAGC T 8612112

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results