Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 150860765 150865942 enh22730

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 150862988 rs573034413 CGCCACAGCTGAGCTGCTGCTGAGAAGTGTA C 8620646

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results