EnhancerDB
  1. Home
  2. TFBS
  3. TFAP2C[chr5:153902250-153902261]
Chromosome characteristics of TFAP2C[chr5:153902250-153902261]
Back to top
Enhancers possibly regulated by TFAP2C[chr5:153902250-153902261]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 153891308 153906695 enh22744
Bone Marrow (K562) Cervix (HeLa-S3) Brain (SK-N-SH) Large Intestine Blood (GM12878) Placenta Peripheral Blood (MM.1S) Pancreas Muscle (Myotube) Heart
SNP sites on TFAP2C[chr5:153902250-153902261]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 153902251 rs377256221 GGCCTTAGGCATGTCATTTCACCTCCCTGA G 8630473
chr5 153902251 rs528018943 GGCCTTAGGCATGTCATTTCACCTCCCTGA G 8630474
Genes possibly regulated by TFAP2C[chr5:153902250-153902261]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TFAP2C[chr5:153902250-153902261]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results