| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr5 | 163068625 | 163072775 | enh22770 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr5 | 163070901 | rs535190713 | A | AGAGGGAGAGAGAGAGGGAGAGAGGGT | 8667159 | |
| chr5 | 163070901 | rs70997069 | A | AGAGGGAGAGAGAGAGGGAGAGAGGGT | 8667160 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|