Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 164025465 164029615 enh84031

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 164026095 rs572349198 C CCTTCCTTCCTGTCCTTCTTTTCCTTT 8669549

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results