Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 167364885 167379590 enh38631

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 167378825 rs544603344 ATATACACACATACATACGCAAATATGTGTG A 8676711

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results