Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 170290725 170294875 enh106131

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 170290837 rs542933793 TGTACTTCACAGTACATTCCAACATAA T 8692990

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results