| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr5 | 170290725 | 170294875 | enh106131 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr5 | 170293285 | rs148752488 | TACAGGAGGTACAAAGGAGACTAAGGAGAGGGGGAAGCAAAAGATA | T | 8693029 | |
| chr5 | 170293285 | rs374102141 | TACAGGAGGTACAAAGGAGACTAAGGAGAGGGGGAAGCAAAAGATA | T | 8693030 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|