Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 170866485 170875456 enh38659

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 170872601 rs542141190 CTCAGGTG C 8694181
chr5 170872608 rs376482568 G T 8694182
chr5 170872610 rs552292397 TCCACCCGCCTTGGCCTCCCAAAGTGCTAG T 8694183

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results