| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr5 | 170866485 | 170875456 | enh38659 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr5 | 170872601 | rs542141190 | CTCAGGTG | C | 8694181 | |
| chr5 | 170872608 | rs376482568 | G | T | 8694182 | |
| chr5 | 170872610 | rs552292397 | TCCACCCGCCTTGGCCTCCCAAAGTGCTAG | T | 8694183 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|