| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr5 | 171660285 | 171665995 | enh55591 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr5 | 171661859 | rs140788749 | CCATGATCATGCCACTGCACTTCAGCCTGGGCGAGAGTGAAACCTCAT | C | 8699507 | |
| chr5 | 171661859 | rs372516667 | CCATGATCATGCCACTGCACTTCAGCCTGGGCGAGAGTGAAACCTCAT | C | 8699508 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|