Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 173492605 173510355 enh106138

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 173495544 rs148558065 G GATGTGGAAGGTGCTGGTGTC 8714966
chr5 173495544 rs370799914 G GATGTGGAAGGTGCTGGTGTC 8714967

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results