EnhancerDB
  1. Home
  2. TFBS
  3. EBF1[chr5:174125571-174125582]
Chromosome characteristics of EBF1[chr5:174125571-174125582]
Back to top
Enhancers possibly regulated by EBF1[chr5:174125571-174125582]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 174124305 174128455 enh97804
Epithelial (MCF-7)
SNP sites on EBF1[chr5:174125571-174125582]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 174125576 rs142603510 TGGGGCTTCTGCTGGTGGCC T 8720021
chr5 174125576 rs574446481 TGGGGCTTCTGCTGGTGGCC T 8720022
Genes possibly regulated by EBF1[chr5:174125571-174125582]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by EBF1[chr5:174125571-174125582]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results