Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 174924425 174931235 enh97810

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 174925089 rs538704310 AATTAATGAGAAAATTAATTATTAATCTT A 8723638

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results