EnhancerDB
  1. Home
  2. TFBS
  3. CTCF[chr5:175160481-175160500]
Chromosome characteristics of CTCF[chr5:175160481-175160500]
Back to top
Enhancers possibly regulated by CTCF[chr5:175160481-175160500]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 175156095 175160593 enh57928
Lung (A549)
SNP sites on CTCF[chr5:175160481-175160500]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 175160500 rs188761440 C T 8725481
chr5 175160500 rs529801096 C CCTTCTGCAGGTTCCTTCTG 8725482
Genes possibly regulated by CTCF[chr5:175160481-175160500]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by CTCF[chr5:175160481-175160500]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results