Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 175600565 175609615 enh101955

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 175607294 rs577801449 TTCCTTAGAAAGGAGTGCTC T 8727192

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results