| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr5 | 176030865 | 176035015 | enh22853 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr5 | 176034751 | rs528126740 | AGGGCACACAACTG | A | 8728845 | |
| chr5 | 176034751 | rs561081482 | AGGGCACACAACTGGGGCACACAACTG | A | 8728846 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|---|---|---|---|---|---|---|---|---|---|---|
| chr5 | 176022803 | 176037134 | - | GPRIN1 | ENSG00000169258.6 | 176037134 | 0.81 | 0.99 | 2379 | 6014 |
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|