Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 176030865 176035015 enh22853

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 176034751 rs528126740 AGGGCACACAACTG A 8728845
chr5 176034751 rs561081482 AGGGCACACAACTGGGGCACACAACTG A 8728846

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr5 176022803 176037134 - GPRIN1 ENSG00000169258.6 176037134 0.81 0.99 2379 6014


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results