Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 176073645 176077795 enh91649

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 176074215 rs538138812 GGGGGCGGGGCCTGGCCGAAGGC G 8728883

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr5 176074388 176086058 + TSPAN17 ENSG00000048140.13 176074388 0.63 1.0 165 6017


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results