EnhancerDB
  1. Home
  2. TFBS
  3. ZNF263[chr5:177398370-177398391]
Chromosome characteristics of ZNF263[chr5:177398370-177398391]
Back to top
Enhancers possibly regulated by ZNF263[chr5:177398370-177398391]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 177396035 177401330 enh46035
Muscle (Myotube)
SNP sites on ZNF263[chr5:177398370-177398391]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 177398372 rs70994948 GAGGACGAAGAGCTGGAGAGCGCCA G 8733714
chr5 177398372 rs71585660 GAGGACGAAGAGCTGGAGAGCGCCA G 8733715
chr5 177398372 rs748474351 GAGGACGAAGAGCTGGAGAGCGCCA G 8733716
chr5 177398380 rs568597025 A C 8733717
Genes possibly regulated by ZNF263[chr5:177398370-177398391]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF263[chr5:177398370-177398391]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results