Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 177652046 177656150 enh102791

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 177655157 rs571376319 CATGGATGCTATGTAATACCAAGAGA C 8735255

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr5 177635498 177659792 - PHYKPL ENSG00000175309.10 177659792 0.75 1.0 4625 6049


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results