Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 177829325 177834295 enh84053

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 177831565 rs142860689 G GTGAAAGTGTGGGGTGAGGGAGGGGCTCGAGA 8737176

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results