Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 180532805 180536955 enh91651

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 180536604 rs35083606 AAGGGCCATCGTGCCCGGCCTTGAAGC A 8751661
chr5 180536604 rs373509203 AAGGGCCATCGTGCCCGGCCTTGAAGC A 8751662
chr5 180536607 rs112352075 G A 8751663

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results