Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 15855325 15862315 enh87226

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 15858136 rs116505264 C A 6577490
chr3 15858136 rs375512719 CACTATTTAACCCACTAGATGCTA C 6577491
chr3 15858136 rs550219927 CACTATTTAACCCACTAGATGCTA C 6577492

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results