Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 30644713 30652115 enh93488
chr6 30649746 30650798 vista51524

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 30650596 rs199834657 T TTGCTTCCTGGCTCCCCTGGGA 8947968

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results