Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 33038663 33038946 vista51630

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 33038897 rs11269757 GGACCCAGTCTGTGCTTGGCCACTTACAGT G 8971147
chr6 33038897 rs67968556 GGACCCAGTCTGTGCTTGGCCACTTACAGT G 8971148

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr6 33043703 33054978 + HLA-DPB1 ENSG00000223865.6 33043703 0.81 0.98 4805 6461


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results