| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr6 | 33038663 | 33038946 | vista51630 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr6 | 33038897 | rs11269757 | GGACCCAGTCTGTGCTTGGCCACTTACAGT | G | 8971147 | |
| chr6 | 33038897 | rs67968556 | GGACCCAGTCTGTGCTTGGCCACTTACAGT | G | 8971148 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|---|---|---|---|---|---|---|---|---|---|---|
| chr6 | 33043703 | 33054978 | + | HLA-DPB1 | ENSG00000223865.6 | 33043703 | 0.81 | 0.98 | 4804 | 6461 |
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|