Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 179787136 179787376 vista50396

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 179787270 rs562133917 A ATTTTACAGAGCGCTGATTGGTGCG 8748405
chr5 179787270 rs6601112 A G 8748406
chr5 179787270 rs71001096 A ATTTTACAGAGCGCTGATTGGTGCG 8748407

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results