Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 179787136 179787376 vista50396

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 179787281 rs550730302 C CGCTGATTGGTGCGTTTTACAGAGT 8748408
chr5 179787282 rs149456306 G A 8748409
chr5 179787282 rs541874387 G GCTGATTGGTGCGTTTTACAGAGCA 8748410
chr5 179787283 rs537706409 C CTGATTGGTGCGTTTTACAGAGCGG 8748411
chr5 179787283 rs7702714 C G 8748412

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results