Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 23867311 23876775 enh33138

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 23873815 rs11275549 C CAAATAGGAAACAAAACTGGAGA 5586233
chr2 23873815 rs533360856 C CAAATAGGAAACAAAACTGGAGA 5586234

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results