Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 24780085 24785695 enh65240

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 24780854 rs541560248 T TGGTTCATTTTCCCAAAATGAACCCTTG 5589391

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results