Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 27094625 27098775 enh76224

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 27098073 rs564715702 G GGTGGAGGGTGGTGAAGGGACAGCTC 5601405
chr2 27098086 rs562311 G A 5601406

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results