Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 28656665 28662655 enh18387

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 28661832 rs548822093 CCTCACCGCTCCCATCTAAGCCACTCA C 5608917

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results