EnhancerDB
  1. Home
  2. TFBS
  3. TP53[chr2:30189230-30189250]
Chromosome characteristics of TP53[chr2:30189230-30189250]
Back to top
Enhancers possibly regulated by TP53[chr2:30189230-30189250]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 30187157 30191391 enh89965
Prostate (RWPE1)
SNP sites on TP53[chr2:30189230-30189250]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 30189237 rs150667435 C A 5617403
chr2 30189245 rs536233228 C T 5617404
chr2 30189245 rs555710726 C CCTTGTCCAGTCCTGCCCAGT 5617405
Genes possibly regulated by TP53[chr2:30189230-30189250]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TP53[chr2:30189230-30189250]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results