Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 30187157 30191391 enh89965

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 30189245 rs536233228 C T 5617404
chr2 30189245 rs555710726 C CCTTGTCCAGTCCTGCCCAGT 5617405

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results