Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 30535945 30540815 enh107789

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 30537130 rs371242199 GTTTTCCTTTCTAGTAAATTT G 5619984
chr2 30537130 rs548226268 GTTTTCCTTTCTAGTAAATTT G 5619985

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results