Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 31502085 31512915 enh18417

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 31506504 rs538920992 AC A 5625801
chr2 31506505 rs569386474 C CCCTGACTCATTCCGATTACCTGCTCCA 5625802
chr2 31506505 rs576893300 C A 5625803

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results