Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 32220785 32234295 enh18421

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 32227513 rs563895015 ATACATATATGAGTTAAATATTCATACTGCAGTT A 5628566

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results